unigene(RDHWG000001)

summary

Unigene name:
Unigene length: 1903
Organism: 黄尾鲴

sequence

DNA sequence: TTGTACATGATGCTTGATTTTTAAATGAATAGTTGACCTACCATTGATAAATCTGTCAACATTTACTCACCCTCATTTTGTTTTCTAACACTTTGTGTAACACCAAAGCAGAAGTTTAGCAGAATATCTCAGCTGTTCTCTTTCAGTACAGTGTACGTGGATGGGGACCAGGGGTTGCCAAGCTCCAAAAAGGGCAAAAAAAAGCACCATACATGTAGTCCATACAACTTGTGCATTATATTGCAAGTCTTCTCAAGCCATAGCTTTGTGTGAGGAGTGACTGAAACATGTTATTTTACACTGAAAACCACACCTTTCACTTTCATTGTATGAAAAAGAGCAGCTTGCACATTAACCTAGATGACTCCTTTTGTGTTCCATGGGGTAGAGAAAATATACGCATTTCAAACAATGGGAAAATGATGACAGAATTTTCATTTTGGTGTTAACTATCCCTTTAAGACTGCTCTTAACTCCCTTTATTTCTATTATATCACAGATTTACTTTTATTCATTCAGCACTTTTATTCAAAGTGTACAAGTAAGAAAAATACAAGTATAAGCACACCTCTGTCAATTGCCTCATGTTGGAGCTGTAATATGAAGTGTAATATTTTTAGTTCAAATACTTTCTACTATACCATATTAATATGCAGACAAACTATAAATTAGCCATTTGTAGGTTGATCGCTCTGTTTGTTTGAGCATCACAACATTGGCTCAACCAATGAAGTGAGTTTAAGGCGGAGCTACCCGTTTGAAAATGTTTTTGCTAATCTGTTTTGTGATGCTAGAGGCTGAGAAATTACACACTTCAGCTTTAATGTAAAGATATTACAAATGCACCTAATATCCATTCAGCTACGCTAAAACAAATACACTTTTTATGCATTCAAGTTACATTTTCAAGAGAAATAATTGAGACATGACTGCCTTTAAGCTCTTTAACATCTCATTGCAGAATTATACATTTTTTTCATGGCAGGACATGATCTTTAATCTTTATAATAAGTGCTGCATTATGCCACTGTGCATTTTGACATGTTAAAGTGATAGCCAATGCCCTGAGAAAGCCTCTTTAAAGGCTCAGTAAACACTACCACAAATGTTAATTTTTCAGTGCAGTCTCCTCTGTTCACCTGCGAACAAAACCTCAGCCACATCCTGTTTTAAAATCTTATTTGCATAACTTAAACATAGATGTGATTAGATCTGTTTAAAATGTTCTCAGTTGTGTGCTTCCTGTGCAGGTAACATTTCAGTCTCTTGTGGAACGACCCTGCAGATAAGGTCATTCTTGCTGTAGGGTCTCTCTCCAGCTGAAGCTATGGTTGGGCCCATGAGTTAAAGGAAGAATTGGTGGATCCACTAGCTGCCAGCCTCCTGACTCGCCCTGCTCCTCACAGGCACAAAGACCCAGGTATGGAATCTTTCGGACTACTTGCACAAAATCTTTAGGATTCTGGGGAGAAAGACCCTGGATCTGGCGAGTGCAGGCCTCCAAAGAGGAAGCATGTCCCACAAACAGAATATTTTTTCCCTTATTTTTGCAGTATGCCAAAATGTCTTTGGTCACCTGGTGGCTGCGATTAATATATGTATCATACGCCTCCGAGATTGTTAGCTTGCTAATGGGGATGTGGGGTCTGTACGTTGTGTCTACATTAAGGTTGGCCGCAGCAAGTTCTGTGGGGGTTATCCAAGCAGGCAAAGATGTTCCTGACACCCATTTTGTCCACTCAAAAAGCCCAGGCTCCACTCGAATGCTTATTCTGCCATCTTGCTGCATTCCTCTGAGGATTTCATGAGCTGTCTGGACACATCGGAGACTGGGTGAGCAGTACACAAAATCAATACTGGTATTACTTTCAAGCAGAGCCTCACCCACTATCTTAGCCTGTAT
Protein sequence: QAKIVGEALLESNTSIDFVYCSPSLRCVQTAHEILRGMQQDGRISIRVEPGLFEWTKWVSGTSLPAWITPTELAAANLNVDTTYRPHIPISKLTISEAYDTYINRSHQVTKDILAYCKNKGKNILFVGHASSLEACTRQIQGLSPQNPKDFVQVVRKIPYLGLCACEEQGESGGWQLVDPPILPLTHGPNHSFSWRETLQQE