unigene(RDFB2000001)

summary

Unigene name:
Unigene length: 855
Organism: 2n鲂鲌

sequence

DNA sequence: GAAATACTGAAGACTGTGGCGGGATCACAGTCAGTCCTACTATCAGCGTTAAAGATCCTGGAAATGTGCAGGTTTATCTGTCATGGATGCAAATATGATACCAAAATTTGCCTCCAAAGACGAGGAAATTGACTTCTGGAAGGCACTTTCGCTGAAGTACAAGAAAAATTATAAAGAGGCACAGGAGGAATTGCTGGAGTTCCAAGAGGGGAGCAGAGAGCTGGAGACAGAGCTGGAGACACAACTGGGCCAAGCGGAGCATCGCATCAGAGACCTGCAGGCAGACAATGAGAGACTGCAGCATGAACTCGATTCGCTCAAGGAGAAGCTGGAATATCAGTATTCTCAGAGCTATAAACAGATCTCTGTACTGGAGGATGACCTCAGCCAGACTCGAGGCATCAAGGAGCAGCTGCATAAATACGTCAGAGAGCTAGAGCAGGCCAATGACGACCTGGAGAGAGCTAAGAGAGCCACGATTACATCTCTGGAAGACTTTGAGCAGAGGCTGAACCAGGCCATCGAGAGGAATGCTTTTCTGGAGAGTGAACTGGATGAGAAAGAGTCTCTCCTGGTGTCTGTGCAGAGACTAAAAGATGAAGCCAGAGATTTGCGGCAAGAGCTTGCGGTGCGAGAGAGCCGACCGGAGGTGACAAGAATGTCGGCCCCCAGCTCCCCGACTCCAGACAATGACAAAACAGACTCAGCAGTCCAGGCCTCCCTCTCTCTGCCGGCTACACCTCTCAGCAAGAACCTGGACAATGCTTTCACCAGCCAGACAGTTCTGGCCAACAGTTCCACTAATGCAGCCCTCACTCCATCTGCTAGAATATCAGCGCTCAATATTGTTGGCGA
Protein sequence: MDANMIPKFASKDEEIDFWKALSLKYKKNYKEAQEELLEFQEGSRELETELETQLGQAEHRIRDLQADNERLQHELDSLKEKLEYQYSQSYKQISVLEDDLSQTRGIKEQLHKYVRELEQANDDLERAKRATITSLEDFEQRLNQAIERNAFLESELDEKESLLVSVQRLKDEARDLRQELAVRESRPEVTRMSAPSSPTPDNDKTDSAVQASLSLPATPLSKNLDNAFTSQTVLANSSTNAALTPSARISALNIVG