unigene(RD2CY000010)

summary

Unigene name:
Unigene length: 319
Organism: 草鱼

sequence

DNA sequence: GTTGAACTATATGAATGGTCCTTTGTCTCCCTGATTCACTTAAGCTTTATAAGTTGACTGGCCCTTTAAGAAGCGTCGCCTGTGTTTTCACTACTACACGACAACACAATACAGCAGCACAACACAAGCCTCTGAGAAGTGAAACAGTCCATCCATCCACAGGCTGCATATCCGTTTCAGTAACATTTTGTTTTTACTGTAACGATGTAGTTAATGACAGAGGAATGCGTTAAGACTCTATTATCATCGTTAGCTTAGCTTACTTTCATCATAAGCAAAGGGAGATTCTAGTAGTGGCTAACGGCTATCAGCTCCAACA