unigene(RD2CY000009)

summary

Unigene name:
Unigene length: 463
Organism: 草鱼

sequence

DNA sequence: ATGGGATTGTGTGCAAGTTAAGGTAACCAGCAGCATTCAGTGACTGACAGGTCACCTGATAACAGTGGCAAAGCACCTAATCTTACTTTCTAAACATATGACTAGAACAGGCTACTAATGTGATCCGACTAGCATGTTGTCGCCTGCTGGCTGCGTAGTGCTGGCCGCAAAGAAGGTCACATTTGCTGAAGGTTTCGTGCACGATGCCCTTTCTAAGTGTACGTGAACAGCTAGCTGATTACAGCTGTCAATTTTAGCATGTCAAACTGTCCACCAACTCTACCTCTCCAAGCGCATTGACCGATCACATCCCCATCTATTTGCCCTCAGCTATTTGAACGACGGAGAGCGCGAGTCTAAGCGATCTACAGAAACCTGACGTTTACCGTCCGCCTAAATAGAGTACTTCAAATCACAAACTTGAGGCTAATAAAAACATCAGATCCCACACTCACACATGCCG