unigene(RD2CY000007)

summary

Unigene name:
Unigene length: 1602
Organism: 草鱼

sequence

DNA sequence: TTTTCATTCTTAGGTTGTTTATTCACAGGTTGTGCAGATTTCTTTTGAGCTTAAAAAAAAATTTCAAGAGTGGAACCCTGAAAGCCCTTGCCACTACAGGTGATGTACATGTGTATAACAATGAAGCTTAATTTAAAAAGCATTAGATAGAAGCATTAATTAAATCATGCTTACATATGATTCTTTATTATACATTAGCAGGGTAAAGTGTTGACAATTCAGTTCTGCTATGATGAGTCATATTTTTAAAACATGTCTGATGAGATTATGGATAATACTGTCCAGAAGCTCTATTACAGACGTGATTTAGAGTGTGCTAGAAAGCCTTTCTGCTCCAGGATCTGTCCGAAGAGTCGAGCAGCTTCCTCAGCACATCCACGATGGATGGTCAGTCCAAAACCTCCATGTCCATAGTTATGGATGACCTCAAGCATGTGTGGTCCAGATCGTATGGTCTCTCTCTCCAGTCTAACTTTGCTGCGTGAGGGCCTGAGACCAGTCCAGTCCTCTACTATCCGTGCATGCTGTAGACTGGGCTCAAGCTTGCAGGCGGCTTCCCAAATTCCTTTATGGTCAACAGAACTGTTCTGCAGATTCCAGTTTCCTACTTGGAAAACTCCACCCACAGTGACTAAACGACTCCCAGGAATGATGTATGGTGAGTTATAGACTCCTAATGAGGAATCGTGCGTGAGAATCCAGTGCTTTAACCATGGAGCGTCTACCTTAATGATCTGTCCTCTGCCTGGTTTGAGCTCAGGATCAGGCTGTAGGTCTCCTGATCGGACACCAGAGCAGTTGATGATAACATCAGCACCACTATCTGCCAACTCTTGAAATGAACCAATCTTCTTCTGATAAAACTTAATCTTTCTTTGTCCTAACCAGTCCATAAGCCAGGGCAGGTATGTCTTTCCTTCAATCATGAGAGCAGTGTTGAACCACCCAAAACTGTATCCTGGAAACATATCTAGTTCACGTTTAGTCAGCTGGCGAAAGCCCAACACGGCATCTTTAAATGAGGGGTCCGCCATAGGTTCAGTGCACAGGTTATAGCCAGACTGGAGGAAGATTCCCATTTTCACTGAATCTGGAGAGCTGAGGAAACTTAGTAGATAGTCAAATGTCTCTTTGTTCCATTTAGTTTCTTGCACGTTCCCCTTGTCATACAGATACGGCTGCCAGAGTCCAGCTGCCCCGTCGCTGGTGGTGAGTGGAGTGAAGATATCAGCATACACCTCTATGTTGAGAGGGGTGACCCTGCCATGGAAGTGCTGGTAGATGCTCTGAGCGGTGGAGAGGCCGATGACCCCCGCTCCAATGATGCACACCTTCATGTCAAACTTTTCTTGTTACCTCCAAAAAGAGATGTCCTAAAAACCAGGTTCTATCTTCTCTCTTGCATGCAGAGTCTTAAGCAATGTAATGACAGGTCGCAAAACTTACAAATTAACTTTTTTCCCACATTACGTAACGTCGACTGTGACGTTAAGGTGGAGCTAGTCATGTATGGGCCGGATTCGGAATAATGCTCGTCTTACTATTTTTTACACGTTACAAATAATAATAGTATGTTATTAAGCCATAGTGGTGGAGTCCGAG