unigene(RD2CY000004)

summary

Unigene name:
Unigene length: 1349
Organism: 草鱼

sequence

DNA sequence: TGATTGCAGATGAAATGCAGTATGGCGGAGCAACACTGAAATAAAACAAAACTGTGCGAAATTCATCGGGATTAAAGCCCGAAATCCTGCCGATTCATCCCACAATCCGCCCGATCTGCGATTATAATCACATACGGATTCACGGCTCGATAAATCGCGCTCTTTGTGTTTGTTGTTAAAGGTGTTTTTGTTTATCGGGAGACCCCGCGATACTTTATGAGCACATTATAAGACAAACACGCTTATTATTATTTATTTTTCGTCTTTATTACGTTCGTTAAATTTAAATTGCGATTCATTCTTTATTAAGCGCGCAAATCTTCACTTTTCGTGCAGAAATCTAACCAGCCCTGTGAAATCACAGGCGTGAAGGTAAAGGCTTGTTTATTATTTTACTAAACATCAAAACGATGGAGAAAAAGCAGCATAAATCAGACAAACATCATCGCCACCACCACCATCATCATCAGTCCTCGAGCAGCAGCAGCAGCAGCGGGGAGTCCGGCGGCAGCAGCCCGGCCCACGGTGCGCCCAAAGCGGCCAACGCCTTCGCCAACGACGGCAGCTTCATGGAGATGTTCAAGAAGAAGATGGAGGAGGAGGAGAGGAGGAAGAGAGAGACCGAGGAGCAGGAGAAGACGAAGAGTCCTGCTCCGGCAGGTCAAGCGGCTCAGGACAAGAAGCCCTGTAGCGTGAGCAGCATTGTAAGAGCGGCAGTGGAAGCGCTTTACATTAGTGTAACATTAACACACACACACATACAGCAGTAGATTCTGGCTCTGTTCGGGTCCTGGCCGCTTCCTAAAACCCGTGTAACGCTCTGAGTCTGTTCCCTTATTAACTCAGGTGGGCAAGCGGAGGGGAGGCGCGCGTTTGGCCCTCAAGACCGGGATGGTGGCCAAGAAACAGAAACTGGACTCTGAGGTGGAGGCTGGAAAAGGAGACGCCTGGACTAAATACATGGCTGAAGTGAAAAAGTATAAAGCGCATCAGTGTGGAGATGATGATAAAACCAGACCACTGGTCAAATAGACTGGAGCTCTTCTGTGGACACGGGCCGCACTGCCACATCCTCATCCTCACACACACACACACACACTGATGTTATTCACGCTGTCCTTCTCTTTTCCTTCAAGTCCTTGTTTCCAGATTGAGTTTTACCTTGTGCGCCGTATTTGACCGTTTGTTGGGTTCCGGTTAATTTTATGACGTTATTTACAGTGTATTCTTTAGTCCATGGCATTAGAAAGATCTCATTCACCTTGTTGATATTTTGTACTCGACATGTTTGGTACTTGAATGTCAGTTGATCAAGATTGATGATGAAATTAAAGTCACAGTACCACAGG