unigene(RD2CY000002)

summary

Unigene name:
Unigene length: 533
Organism: 草鱼

sequence

DNA sequence: GGAAAAAAGAAATTGGAAGCTGCTGCAGCTGCCCAGGAAGATCGAGACAAACCGTATGCTTGTGACATATGTGGGAAACGCTATAAGAACAGACCAGGCTTGAGTTACCACTACACTCACTCTCACCTGGCTGATGAGGAGGGCGAAGACAAAGAAGAACCTGAGATTCACACACCTGCGCCACCAGAGGAACCCAAGACCCCTAAAAAAGGACCAAACGGCCTGGCATTACCCAATGACTATTGCGACTTCTGCCTGGGTGACTCCAACATGAACCAGAAAACGGGCCAGTCTGAAGAGCTGGTGTCCTGCTCTGACTGTGGACGTTCAGGACATCCTTCGTGCCTGCAGTTCACTGCCGTGATGATGGCAGCTGTGAAGACGTACCGCTGGCAGTGCATTGAGTGCAAGTGCTGCAATGTTTGTGGCACATCTGAGAATGACGACCAGCTTCTGTTCTGTGATGACTGTGACAGAGGATATCACATGTACTGCCTCAGCCCTCCCATGTCAGACCCTCCAGAAGGAAGCTG